Résultats pour split gfp

 
split gfp
 
Protein-fragment complementation assay Wikipedia.
General principle of the protein complementation assay: a protein is split into two N and C-terminal halves and reconstituted by two interacting proteins here called bait" and prey" because a bait protein can be used to find an interacting prey protein. The activity of the reconstituted protein should be easily detectable, e.g. as in the green fluorescent protein GFP.
mannequin
Addgene: pcDNA3.1 ZKSCAN1 MCS-WT Split GFP Sequences.
Full Sequences from Depositor 1. pcDNA3.1 ZKSCAN1 MCS-WT Split GFP sequence 7424 bps GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTT AAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACA ACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCG ATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTC ATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGC AGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAA TGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACG CAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCA CTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTT AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGgaattcAGTGACAGTGGAGATTGTACAGT TTTTTCCTCGATTTGTCAGGAttttttttttttgacggagtttaacttcttgtctcccaggtaggaagtg cagtggcgtaatctcggctcactacaacctccacctcctgggttcaagcgtttctcctgcctcagctttc cgagtagctgggattacaggcgcctgccaccatgccctgctgacttttgtatttttagtagagacggggt ttcaccatgttggccaggctggtcttgaactcctgaccgcaggcgattggcctgcctcggcctcccaaag tgctgagattacaggcgtgagccaccacccccggccTCAGGAGCGTTCTGATAGTGCCTCGATGTGCTGC CTCCTATAAAGTGTTAGCAGCACAGATCACTTTTTGTAAAGGTACGTACTAATGACTTTTTTTTTATACT TCAGGATggcagcgtgcagctggccgaccactaccagcagaatacccccatcggcgatggccctgtgctg ctgcccgataaccactacctgtccacccagagcgccctgtccaaggaccccaacgagaagcgcgatcaca tgatCTACTTCGGCttcgtgaccgccgccgCcatcacccacggcatggacgagctgtacaagtgaATCGA TACCGGTTTAATTAACACGTGGGTAACCGTTCCGAGTCGTTAACCACCatggccagcaagggcgCCgagc tgttcaccggcAtCgtgcccatcctgAtCgagctgAaTggcgatgtgaatggccacaagttcagcgtgag cggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctg cctgtgccctggcccaccctggtgaccaccctgagctacggcgtgcagtgcttctcacgctaccccgatc acatgaagcagcacgacttcttcaagagcgccatgcctgagggctacatccaggagcgcaccatcttctt cgaggatgacggcaactacaagtcgcgcgccgaggtgaagttcgagggcgataccctggtgaatcgcatc gagctgaccggcaccgatttcaaggaggatggcaacatcctgggcaataagatggagtacaactacaacg cccacaatgtgtacatcatgaccgacaaggccaagaatggcatcaaggtgaacttcaagatccgccacaA CATCGAGGTAAGAAGCAAGGTTTCATTTAGGGGAAGGGAAATGATTCAGGACGAGAGTCTTTGTGCTGCT GAGTGCCTGTGATGAAGAAGCATGTTAGTcctgggcaacgtagcgagaccccatctctacaaaaaataga aaaattagccaggtatagtggcgcacacctgtgattccagctacgcaggaggctgaggtgggaggattgc ttgagcccaggaggttgaggctgcagtgagctgtaatcatgccactactccaacctgggcaacacagcaa ggaccctgtctcaaaaGCTACTTACAGAAAAGAATTAggctcggcacggtagctcacacctgtaatccca gcactttgggaggctgaggcgggcagatcacttgaggtcaggagtttgagaccagcctggccaacatggt gaaaccttgtctctactaaaaatatgaaaattagccaggcatggtggcacattcctgtaatcccagctac tcgggaggctgaggcaggagaatcacttgaacccaggaggtggaggttgcagtaagccgagatcgtacca ctgtgctctagccttggtgacagagcgagactgtcttaaaaaaaaaaaaaaaaaaaaaagaattaattaa aaatttaaaaaaaaatgaaaaaaaGCTGCATGCTTGTTTTTTGTTTTTAGTTATTCTACATTGTTGTCAT TATTACCAAATATTGGGGAAAATACAACTTACAGACCAATCTCAGGAGTTAAATGTTACTACGAAGGCAA ATGAACTATGCGTAATGAACCTGGTAGGCATTAgcggccgcTCGAGTCTAGAGGGCCCGTTTAAACCCGC TGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGA CCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAG GTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGG CATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATC CCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACT TGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCC CGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAA AACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTT GGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTAT TCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAAT TTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAG GCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCC GCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAG GCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTT GCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCG CATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGAC TGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTC TTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCT GGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTA TTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGG CTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCG CATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGA CCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGG CCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGC GGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCT ATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAAC CTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGG ACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTAT TGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTG CATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCT AGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA CATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCG TTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCG CGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGT TCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAAC GCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGT TTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCC GACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTG CCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTA GGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGA CCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCA GCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGC CTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAA AAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAG ATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGA ACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAA TTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGT AGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTC ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACT TTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTT TGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAG CTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTC GGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATA ATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTG AGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGC AGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGT TGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGT TTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA ATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACA TATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA CGTC.
https://www.seopageoptimizer.de/de/default/2008933/SEO/Analyse.aspx
Green Fluorescent Protein: Properties, Applications and Protocols Google Livres.
Acad Aequorea GFP Aequorea victoria aequorin amino acid analysis Anthozoa assays bacteria Biochem Biochemistry bioluminescence Biotechnol Caenorhabditis elegans Cell Biol cellular Chale chromophore chromosome cloned Cnidaria color confocal coral Cormier detection dimer domains Drosophila DsRed dynamics efcient elegans embryos emission energy transfer excitation expressing GFP lter rst ow Fluorescent uorophore FRET function fusion protein gene expression genetic GFP expression GFP uorescence GFP fusion proteins GFP-like proteins green uorescent protein Heim identied imaging interactions jellysh living cells localization luciferase luciferin Lukyanov luminescence mammalian cells marker Matz membrane microscopy microtubules molecular molecules Morin mutants Natl neurons nuclear peptide photobleaching plasmid Prasher Proc quantum yield RCFPs receptor recombinant red uorescent protein Renilla luciferase residues screening sequence Shimomura signal specic spectral studies subcellular target tion tissue transcription transfected transgenic Tsien vectors visualized vivo Ward wavelengths wild-type GFP yeast zebrash.
numero
High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation Journal of Cell Science.
The percentage of GFP cells was calculated as: percentage GFP cellsnumber of GFP-positive cells/number of all objects100, where GFP-positive cells are defined by cells following this criteria: mean of fluorescence intensity MFI of the objectmean of MFI in the control wells without doxycycline.
bruxelles
Split-gfp.
Coupons
Versatile protein tagging in cells with split fluorescent protein.
For this purpose, we adopted a split super-folder GFP sfGFP that was previously engineered for efficient self-complementation without the assistance of other proteinprotein interactions 5. This split construct breaks the sequence of sfGFP between the tenth and the eleventh strand into two parts: GFP1-10 and GFP11, with GFP11 being a short, 16 amino acid peptide Fig.
best vpn download
PDF A New Protein-Protein Interaction Sensor Based on Tripartite Split-GFP Association.
neously assembling split GFP based on GFP 1011 residues 194233, the tag and GFP1-9 residues 1193, the. detector Waldo lab, unpublished results. Here we describe the further engineering of this split GFP to yield an. entirely new protein interaction assay based on the association of three fragments of the GFP: two short peptides.
impression t shirt
Prodinra.
Activity-independent screening of secreted proteins using split GFP ScienceDirect. ScienceDirect.
Respective high-throughput screening methods are usually based on photometric or fluorimetric assays enabling fast and simple determination of enzymatic activities. Here, we report on an alternative method for quantification of secreted proteins based on the split GFP assay. We analyzed the secretion by Bacillus subtilis of a homologous lipase and a heterologous cutinase by determination of GFP fluorescence and enzyme activity assays.

Contactez nous